Review



h89 tocris  (Tocris)


Bioz Verified Symbol Tocris is a verified supplier
Bioz Manufacturer Symbol Tocris manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 95
      Buy from Supplier

    Structured Review

    Tocris h89 tocris
    H89 Tocris, supplied by Tocris, used in various techniques. Bioz Stars score: 95/100, based on 150 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/h89+tocris/H+89+dihydrochloride/pm41903111-517-60-61
    Average 95 stars, based on 150 article reviews
    h89 tocris - by Bioz Stars, 2026-11
    95/100 stars

    Images

    Related Articles

    Solvent:

    Article Title: Mechanisms of norepinephrine induced Ca 2+ responses in perivascular adipose tissue.
    Article Snippet: .. 773 774 TABLES 775 Table 1: 776 777 Drug Vendor Catalog # Amount used to prepare stock Solvent Amount of solvent for stock (ul or mL) Stock concentration (mM) Final working concentration (μM) Reference(s) DlNorepinephrine Sigma Aldrich A7256 1 mg 1xKrebs 0.5 mL 10mM 10 μM (19, 41) Thapsigargin Tocris (US) 1138 1 mg DMSO 60μl 25mM 10 μM (39) H89 Tocris (US) 2910 1.03 mg 1xKrebs 1 mL 1.98 mM 10 μM (40, 41) Downloaded from journals.physiology.org/journal/ajpendo (2402:0800:6343:DF27:7D60:CF16:1511:DB5B) on March 31, 2026. .. U73122 Tocris (US) 1268 1.16 mg DMSO 0.5 mL 60mM 10 μM (42, 43) RS 100329 Tocris (US) 1325 2.3 mg 1xKrebs 1mL 5mM 1 μM (44) SR 59230A Tocris (US) 1511 1 mg 1xKrebs 1mL 2.7631mM 6.5 μM (45) Gallein Tocris (US) 3090 1 mg DMSO 200 μl 15mM 10 μM (46) Formoterol hemifumarate Tocris (US) 1448 2.01 mg DMSO 0.5 mL 10mM 100 μM (21, 47) A 61603 hydrobromide Tocris (US) 1052 1.17 mg 1xKrebs 0.5 mL 6mM 0.1 μM (21) CL 316243 disodium salt Tocris (US) 1499 1.16mg 1xKrebs 0.5 mL 5mM 10 μM (16) 778 785 Downloaded from journals.physiology.org/journal/ajpendo (2402:0800:6343:DF27:7D60:CF16:1511:DB5B) on March 31, 2026.

    Concentration Assay:

    Article Title: Mechanisms of norepinephrine induced Ca 2+ responses in perivascular adipose tissue.
    Article Snippet: .. 773 774 TABLES 775 Table 1: 776 777 Drug Vendor Catalog # Amount used to prepare stock Solvent Amount of solvent for stock (ul or mL) Stock concentration (mM) Final working concentration (μM) Reference(s) DlNorepinephrine Sigma Aldrich A7256 1 mg 1xKrebs 0.5 mL 10mM 10 μM (19, 41) Thapsigargin Tocris (US) 1138 1 mg DMSO 60μl 25mM 10 μM (39) H89 Tocris (US) 2910 1.03 mg 1xKrebs 1 mL 1.98 mM 10 μM (40, 41) Downloaded from journals.physiology.org/journal/ajpendo (2402:0800:6343:DF27:7D60:CF16:1511:DB5B) on March 31, 2026. .. U73122 Tocris (US) 1268 1.16 mg DMSO 0.5 mL 60mM 10 μM (42, 43) RS 100329 Tocris (US) 1325 2.3 mg 1xKrebs 1mL 5mM 1 μM (44) SR 59230A Tocris (US) 1511 1 mg 1xKrebs 1mL 2.7631mM 6.5 μM (45) Gallein Tocris (US) 3090 1 mg DMSO 200 μl 15mM 10 μM (46) Formoterol hemifumarate Tocris (US) 1448 2.01 mg DMSO 0.5 mL 10mM 100 μM (21, 47) A 61603 hydrobromide Tocris (US) 1052 1.17 mg 1xKrebs 0.5 mL 6mM 0.1 μM (21) CL 316243 disodium salt Tocris (US) 1499 1.16mg 1xKrebs 0.5 mL 5mM 10 μM (16) 778 785 Downloaded from journals.physiology.org/journal/ajpendo (2402:0800:6343:DF27:7D60:CF16:1511:DB5B) on March 31, 2026.

    Recombinant:

    Article Title: Disruption of Coronin 1 Signaling in T Cells Promotes Allograft Tolerance while Maintaining Anti-Pathogen Immunity.
    Article Snippet: .. N/A Chemicals, Peptides, and Recombinant Proteins Histopaque Sigma Cat # 10771 H89 Tocris Cat # 2910/1 KN93 Tocris Cat # 1278/1 Forskolin Tocris Cat # 1099 Rolipram Tocris Cat # 0905 Protease inhibitor Roche Cat # 11873580001 HALT cocktail ThermoFisher Cat # 78420 Histopaque Sigma Cat # 10771 CFSE Thermo Fisher Cat # C34554 CTV Thermo Fisher Cat # C34557 RBC lysis buffer BD Cat # 349202 Miglyol 812 N IOI Oleo N/A Kolliphor EL Sigma Cat# C5315 Dnase1 Roche Cat# 11284932001 Collagenase Merck Cat# SCR103 Hyaluronidase type IV Sigma Cat# H4272 Paraformaldehyde Sigma Cat # 252549 Critical Commercial Assays FoxP3 staining kit Biolegend Cat# 320019, RRID:AB_10120926 Total T cell isolation Kit Stemcell technologies Cat # 19851A CD4 T cell isolation kit Stemcell technologies Cat # 19852A Treg isolation kit Stemcell technologies Cat # 18782 cAMP femto kit CisBio Cat # 62AM5PEB cAMP ELISA kit R&D Cat # SKGE002 PepTag assay kit Promega Cat # V5340 Deposited Data RNA-seq analysis This paper GEO; GSE122567 Experimental Models: Cell Lines Jurkat ATCC, TIB-152 RRID:CVCL_0367 Experimental Models: Organisms/Strains WT C57BL/6 Janvier https://www.janvier-labs.com Coro1a / C57BL/6 Jayachandran et al., 2007. https://www.jax.org/strain/030203 Rag2 / Gift from Dr. Ed Palmer. .. Shinkai et al., 1992 N/A BDF1 Janvier https://www.janvier-labs.com/rodent- research-models-services/research-models/ per-species/hybrid-mice/product/b6d2f1.html BALB/C Janvier https://www.janvier-labs.com Recombinant DNA pSpCas9(BB)-2A-GFP (PX458), Guide sequence TTCATAGCACTGGTCGGCCTTGG Addgene Plasmid # 48138 (Continued on next page) e2 Immunity 50, 1–14.e1–e8, January 15, 2019

    Protease Inhibitor:

    Article Title: Disruption of Coronin 1 Signaling in T Cells Promotes Allograft Tolerance while Maintaining Anti-Pathogen Immunity.
    Article Snippet: .. N/A Chemicals, Peptides, and Recombinant Proteins Histopaque Sigma Cat # 10771 H89 Tocris Cat # 2910/1 KN93 Tocris Cat # 1278/1 Forskolin Tocris Cat # 1099 Rolipram Tocris Cat # 0905 Protease inhibitor Roche Cat # 11873580001 HALT cocktail ThermoFisher Cat # 78420 Histopaque Sigma Cat # 10771 CFSE Thermo Fisher Cat # C34554 CTV Thermo Fisher Cat # C34557 RBC lysis buffer BD Cat # 349202 Miglyol 812 N IOI Oleo N/A Kolliphor EL Sigma Cat# C5315 Dnase1 Roche Cat# 11284932001 Collagenase Merck Cat# SCR103 Hyaluronidase type IV Sigma Cat# H4272 Paraformaldehyde Sigma Cat # 252549 Critical Commercial Assays FoxP3 staining kit Biolegend Cat# 320019, RRID:AB_10120926 Total T cell isolation Kit Stemcell technologies Cat # 19851A CD4 T cell isolation kit Stemcell technologies Cat # 19852A Treg isolation kit Stemcell technologies Cat # 18782 cAMP femto kit CisBio Cat # 62AM5PEB cAMP ELISA kit R&D Cat # SKGE002 PepTag assay kit Promega Cat # V5340 Deposited Data RNA-seq analysis This paper GEO; GSE122567 Experimental Models: Cell Lines Jurkat ATCC, TIB-152 RRID:CVCL_0367 Experimental Models: Organisms/Strains WT C57BL/6 Janvier https://www.janvier-labs.com Coro1a / C57BL/6 Jayachandran et al., 2007. https://www.jax.org/strain/030203 Rag2 / Gift from Dr. Ed Palmer. .. Shinkai et al., 1992 N/A BDF1 Janvier https://www.janvier-labs.com/rodent- research-models-services/research-models/ per-species/hybrid-mice/product/b6d2f1.html BALB/C Janvier https://www.janvier-labs.com Recombinant DNA pSpCas9(BB)-2A-GFP (PX458), Guide sequence TTCATAGCACTGGTCGGCCTTGG Addgene Plasmid # 48138 (Continued on next page) e2 Immunity 50, 1–14.e1–e8, January 15, 2019


    Red Blood Cell Lysis:

    Article Title: Disruption of Coronin 1 Signaling in T Cells Promotes Allograft Tolerance while Maintaining Anti-Pathogen Immunity.
    Article Snippet: .. N/A Chemicals, Peptides, and Recombinant Proteins Histopaque Sigma Cat # 10771 H89 Tocris Cat # 2910/1 KN93 Tocris Cat # 1278/1 Forskolin Tocris Cat # 1099 Rolipram Tocris Cat # 0905 Protease inhibitor Roche Cat # 11873580001 HALT cocktail ThermoFisher Cat # 78420 Histopaque Sigma Cat # 10771 CFSE Thermo Fisher Cat # C34554 CTV Thermo Fisher Cat # C34557 RBC lysis buffer BD Cat # 349202 Miglyol 812 N IOI Oleo N/A Kolliphor EL Sigma Cat# C5315 Dnase1 Roche Cat# 11284932001 Collagenase Merck Cat# SCR103 Hyaluronidase type IV Sigma Cat# H4272 Paraformaldehyde Sigma Cat # 252549 Critical Commercial Assays FoxP3 staining kit Biolegend Cat# 320019, RRID:AB_10120926 Total T cell isolation Kit Stemcell technologies Cat # 19851A CD4 T cell isolation kit Stemcell technologies Cat # 19852A Treg isolation kit Stemcell technologies Cat # 18782 cAMP femto kit CisBio Cat # 62AM5PEB cAMP ELISA kit R&D Cat # SKGE002 PepTag assay kit Promega Cat # V5340 Deposited Data RNA-seq analysis This paper GEO; GSE122567 Experimental Models: Cell Lines Jurkat ATCC, TIB-152 RRID:CVCL_0367 Experimental Models: Organisms/Strains WT C57BL/6 Janvier https://www.janvier-labs.com Coro1a / C57BL/6 Jayachandran et al., 2007. https://www.jax.org/strain/030203 Rag2 / Gift from Dr. Ed Palmer. .. Shinkai et al., 1992 N/A BDF1 Janvier https://www.janvier-labs.com/rodent- research-models-services/research-models/ per-species/hybrid-mice/product/b6d2f1.html BALB/C Janvier https://www.janvier-labs.com Recombinant DNA pSpCas9(BB)-2A-GFP (PX458), Guide sequence TTCATAGCACTGGTCGGCCTTGG Addgene Plasmid # 48138 (Continued on next page) e2 Immunity 50, 1–14.e1–e8, January 15, 2019

    Staining:

    Article Title: Disruption of Coronin 1 Signaling in T Cells Promotes Allograft Tolerance while Maintaining Anti-Pathogen Immunity.
    Article Snippet: .. N/A Chemicals, Peptides, and Recombinant Proteins Histopaque Sigma Cat # 10771 H89 Tocris Cat # 2910/1 KN93 Tocris Cat # 1278/1 Forskolin Tocris Cat # 1099 Rolipram Tocris Cat # 0905 Protease inhibitor Roche Cat # 11873580001 HALT cocktail ThermoFisher Cat # 78420 Histopaque Sigma Cat # 10771 CFSE Thermo Fisher Cat # C34554 CTV Thermo Fisher Cat # C34557 RBC lysis buffer BD Cat # 349202 Miglyol 812 N IOI Oleo N/A Kolliphor EL Sigma Cat# C5315 Dnase1 Roche Cat# 11284932001 Collagenase Merck Cat# SCR103 Hyaluronidase type IV Sigma Cat# H4272 Paraformaldehyde Sigma Cat # 252549 Critical Commercial Assays FoxP3 staining kit Biolegend Cat# 320019, RRID:AB_10120926 Total T cell isolation Kit Stemcell technologies Cat # 19851A CD4 T cell isolation kit Stemcell technologies Cat # 19852A Treg isolation kit Stemcell technologies Cat # 18782 cAMP femto kit CisBio Cat # 62AM5PEB cAMP ELISA kit R&D Cat # SKGE002 PepTag assay kit Promega Cat # V5340 Deposited Data RNA-seq analysis This paper GEO; GSE122567 Experimental Models: Cell Lines Jurkat ATCC, TIB-152 RRID:CVCL_0367 Experimental Models: Organisms/Strains WT C57BL/6 Janvier https://www.janvier-labs.com Coro1a / C57BL/6 Jayachandran et al., 2007. https://www.jax.org/strain/030203 Rag2 / Gift from Dr. Ed Palmer. .. Shinkai et al., 1992 N/A BDF1 Janvier https://www.janvier-labs.com/rodent- research-models-services/research-models/ per-species/hybrid-mice/product/b6d2f1.html BALB/C Janvier https://www.janvier-labs.com Recombinant DNA pSpCas9(BB)-2A-GFP (PX458), Guide sequence TTCATAGCACTGGTCGGCCTTGG Addgene Plasmid # 48138 (Continued on next page) e2 Immunity 50, 1–14.e1–e8, January 15, 2019

    Cell Isolation:

    Article Title: Disruption of Coronin 1 Signaling in T Cells Promotes Allograft Tolerance while Maintaining Anti-Pathogen Immunity.
    Article Snippet: .. N/A Chemicals, Peptides, and Recombinant Proteins Histopaque Sigma Cat # 10771 H89 Tocris Cat # 2910/1 KN93 Tocris Cat # 1278/1 Forskolin Tocris Cat # 1099 Rolipram Tocris Cat # 0905 Protease inhibitor Roche Cat # 11873580001 HALT cocktail ThermoFisher Cat # 78420 Histopaque Sigma Cat # 10771 CFSE Thermo Fisher Cat # C34554 CTV Thermo Fisher Cat # C34557 RBC lysis buffer BD Cat # 349202 Miglyol 812 N IOI Oleo N/A Kolliphor EL Sigma Cat# C5315 Dnase1 Roche Cat# 11284932001 Collagenase Merck Cat# SCR103 Hyaluronidase type IV Sigma Cat# H4272 Paraformaldehyde Sigma Cat # 252549 Critical Commercial Assays FoxP3 staining kit Biolegend Cat# 320019, RRID:AB_10120926 Total T cell isolation Kit Stemcell technologies Cat # 19851A CD4 T cell isolation kit Stemcell technologies Cat # 19852A Treg isolation kit Stemcell technologies Cat # 18782 cAMP femto kit CisBio Cat # 62AM5PEB cAMP ELISA kit R&D Cat # SKGE002 PepTag assay kit Promega Cat # V5340 Deposited Data RNA-seq analysis This paper GEO; GSE122567 Experimental Models: Cell Lines Jurkat ATCC, TIB-152 RRID:CVCL_0367 Experimental Models: Organisms/Strains WT C57BL/6 Janvier https://www.janvier-labs.com Coro1a / C57BL/6 Jayachandran et al., 2007. https://www.jax.org/strain/030203 Rag2 / Gift from Dr. Ed Palmer. .. Shinkai et al., 1992 N/A BDF1 Janvier https://www.janvier-labs.com/rodent- research-models-services/research-models/ per-species/hybrid-mice/product/b6d2f1.html BALB/C Janvier https://www.janvier-labs.com Recombinant DNA pSpCas9(BB)-2A-GFP (PX458), Guide sequence TTCATAGCACTGGTCGGCCTTGG Addgene Plasmid # 48138 (Continued on next page) e2 Immunity 50, 1–14.e1–e8, January 15, 2019

    Isolation:

    Article Title: Disruption of Coronin 1 Signaling in T Cells Promotes Allograft Tolerance while Maintaining Anti-Pathogen Immunity.
    Article Snippet: .. N/A Chemicals, Peptides, and Recombinant Proteins Histopaque Sigma Cat # 10771 H89 Tocris Cat # 2910/1 KN93 Tocris Cat # 1278/1 Forskolin Tocris Cat # 1099 Rolipram Tocris Cat # 0905 Protease inhibitor Roche Cat # 11873580001 HALT cocktail ThermoFisher Cat # 78420 Histopaque Sigma Cat # 10771 CFSE Thermo Fisher Cat # C34554 CTV Thermo Fisher Cat # C34557 RBC lysis buffer BD Cat # 349202 Miglyol 812 N IOI Oleo N/A Kolliphor EL Sigma Cat# C5315 Dnase1 Roche Cat# 11284932001 Collagenase Merck Cat# SCR103 Hyaluronidase type IV Sigma Cat# H4272 Paraformaldehyde Sigma Cat # 252549 Critical Commercial Assays FoxP3 staining kit Biolegend Cat# 320019, RRID:AB_10120926 Total T cell isolation Kit Stemcell technologies Cat # 19851A CD4 T cell isolation kit Stemcell technologies Cat # 19852A Treg isolation kit Stemcell technologies Cat # 18782 cAMP femto kit CisBio Cat # 62AM5PEB cAMP ELISA kit R&D Cat # SKGE002 PepTag assay kit Promega Cat # V5340 Deposited Data RNA-seq analysis This paper GEO; GSE122567 Experimental Models: Cell Lines Jurkat ATCC, TIB-152 RRID:CVCL_0367 Experimental Models: Organisms/Strains WT C57BL/6 Janvier https://www.janvier-labs.com Coro1a / C57BL/6 Jayachandran et al., 2007. https://www.jax.org/strain/030203 Rag2 / Gift from Dr. Ed Palmer. .. Shinkai et al., 1992 N/A BDF1 Janvier https://www.janvier-labs.com/rodent- research-models-services/research-models/ per-species/hybrid-mice/product/b6d2f1.html BALB/C Janvier https://www.janvier-labs.com Recombinant DNA pSpCas9(BB)-2A-GFP (PX458), Guide sequence TTCATAGCACTGGTCGGCCTTGG Addgene Plasmid # 48138 (Continued on next page) e2 Immunity 50, 1–14.e1–e8, January 15, 2019

    Enzyme-linked Immunosorbent Assay:

    Article Title: Disruption of Coronin 1 Signaling in T Cells Promotes Allograft Tolerance while Maintaining Anti-Pathogen Immunity.
    Article Snippet: .. N/A Chemicals, Peptides, and Recombinant Proteins Histopaque Sigma Cat # 10771 H89 Tocris Cat # 2910/1 KN93 Tocris Cat # 1278/1 Forskolin Tocris Cat # 1099 Rolipram Tocris Cat # 0905 Protease inhibitor Roche Cat # 11873580001 HALT cocktail ThermoFisher Cat # 78420 Histopaque Sigma Cat # 10771 CFSE Thermo Fisher Cat # C34554 CTV Thermo Fisher Cat # C34557 RBC lysis buffer BD Cat # 349202 Miglyol 812 N IOI Oleo N/A Kolliphor EL Sigma Cat# C5315 Dnase1 Roche Cat# 11284932001 Collagenase Merck Cat# SCR103 Hyaluronidase type IV Sigma Cat# H4272 Paraformaldehyde Sigma Cat # 252549 Critical Commercial Assays FoxP3 staining kit Biolegend Cat# 320019, RRID:AB_10120926 Total T cell isolation Kit Stemcell technologies Cat # 19851A CD4 T cell isolation kit Stemcell technologies Cat # 19852A Treg isolation kit Stemcell technologies Cat # 18782 cAMP femto kit CisBio Cat # 62AM5PEB cAMP ELISA kit R&D Cat # SKGE002 PepTag assay kit Promega Cat # V5340 Deposited Data RNA-seq analysis This paper GEO; GSE122567 Experimental Models: Cell Lines Jurkat ATCC, TIB-152 RRID:CVCL_0367 Experimental Models: Organisms/Strains WT C57BL/6 Janvier https://www.janvier-labs.com Coro1a / C57BL/6 Jayachandran et al., 2007. https://www.jax.org/strain/030203 Rag2 / Gift from Dr. Ed Palmer. .. Shinkai et al., 1992 N/A BDF1 Janvier https://www.janvier-labs.com/rodent- research-models-services/research-models/ per-species/hybrid-mice/product/b6d2f1.html BALB/C Janvier https://www.janvier-labs.com Recombinant DNA pSpCas9(BB)-2A-GFP (PX458), Guide sequence TTCATAGCACTGGTCGGCCTTGG Addgene Plasmid # 48138 (Continued on next page) e2 Immunity 50, 1–14.e1–e8, January 15, 2019

    RNA Sequencing:

    Article Title: Disruption of Coronin 1 Signaling in T Cells Promotes Allograft Tolerance while Maintaining Anti-Pathogen Immunity.
    Article Snippet: .. N/A Chemicals, Peptides, and Recombinant Proteins Histopaque Sigma Cat # 10771 H89 Tocris Cat # 2910/1 KN93 Tocris Cat # 1278/1 Forskolin Tocris Cat # 1099 Rolipram Tocris Cat # 0905 Protease inhibitor Roche Cat # 11873580001 HALT cocktail ThermoFisher Cat # 78420 Histopaque Sigma Cat # 10771 CFSE Thermo Fisher Cat # C34554 CTV Thermo Fisher Cat # C34557 RBC lysis buffer BD Cat # 349202 Miglyol 812 N IOI Oleo N/A Kolliphor EL Sigma Cat# C5315 Dnase1 Roche Cat# 11284932001 Collagenase Merck Cat# SCR103 Hyaluronidase type IV Sigma Cat# H4272 Paraformaldehyde Sigma Cat # 252549 Critical Commercial Assays FoxP3 staining kit Biolegend Cat# 320019, RRID:AB_10120926 Total T cell isolation Kit Stemcell technologies Cat # 19851A CD4 T cell isolation kit Stemcell technologies Cat # 19852A Treg isolation kit Stemcell technologies Cat # 18782 cAMP femto kit CisBio Cat # 62AM5PEB cAMP ELISA kit R&D Cat # SKGE002 PepTag assay kit Promega Cat # V5340 Deposited Data RNA-seq analysis This paper GEO; GSE122567 Experimental Models: Cell Lines Jurkat ATCC, TIB-152 RRID:CVCL_0367 Experimental Models: Organisms/Strains WT C57BL/6 Janvier https://www.janvier-labs.com Coro1a / C57BL/6 Jayachandran et al., 2007. https://www.jax.org/strain/030203 Rag2 / Gift from Dr. Ed Palmer. .. Shinkai et al., 1992 N/A BDF1 Janvier https://www.janvier-labs.com/rodent- research-models-services/research-models/ per-species/hybrid-mice/product/b6d2f1.html BALB/C Janvier https://www.janvier-labs.com Recombinant DNA pSpCas9(BB)-2A-GFP (PX458), Guide sequence TTCATAGCACTGGTCGGCCTTGG Addgene Plasmid # 48138 (Continued on next page) e2 Immunity 50, 1–14.e1–e8, January 15, 2019

    other:

    Article Title: Early deficits in an in vitro striatal microcircuit model carrying the Parkinson’s GBA-N370S mutation
    Article Snippet: H89 (Tocris) was dissolved in dH2O and were media applied to the middle chamber to the final concentrations of 10 μM for 15 min prior to wash off and recording.

    Article Title: Early deficits in an in vitro striatal microcircuit model carrying the Parkinson's GBA-N370S mutation.
    Article Snippet: H89 (Tocris) was dissolved in dH2O and were media applied to the middle chamber to the final concentrations of 10 μM for 15min prior to wash off and recording.

    Control:


    Construct:


    Software:




    Similar Products

    h89 tocris  (Tocris)
    95
    Tocris h89 tocris
    H89 Tocris, supplied by Tocris, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/h89+tocris/H+89+dihydrochloride/pm41903111-517-60-61
    Average 95 stars, based on 1 article reviews
    h89 tocris - by Bioz Stars, 2026-11
    95/100 stars
    		  Buy from Supplier
    h89 dihydrochloride tocris  (Tocris)
    90
    Tocris h89 dihydrochloride tocris
    H89 Dihydrochloride Tocris, supplied by Tocris, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/h89+tocris/h89+tocris++2910/pm38777862-318-2-6
    Average 90 stars, based on 1 article reviews
    h89 dihydrochloride tocris - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    h89 tocris bioscience  (Tocris)
    90
    Tocris h89 tocris bioscience
    H89 Tocris Bioscience, supplied by Tocris, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/h89+tocris/h89+tocris++2910/10__1523_slash_eneuro__0089___23__2023-43-0-1
    Average 90 stars, based on 1 article reviews
    h89 tocris bioscience - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    drug h89 tocris  (Tocris)
    95
    Tocris drug h89 tocris
    Figure 4. Increased PP2A activity maintains tetrodotoxin (TTX)-induced Shank3 hypophosphorylation. (A) Diagram showing the potential roles of kinases and phosphatases in regulating activity-dependent Shank3 phosphorylation. (B) Representative Western blot showing the impacts of inhibiting CAMKII (KN62, KN93) or PKA <t>(H89)</t> on Shank3 phosphorylation at baseline and upon TTX treatment. (C) Quantification of S1615 phosphorylation in (B) (two-way ANOVA with post-hoc Tukey’s test: DMSO vs. KN62, p>0.9999, DMSO vs. KN93, p=0.8148, DMSO vs. H89, p=0.9112, DMSO vs. picrotoxin (PTX), *p=0.0406, PTX vs. PTX/KN62, **p=0.0040, PTX vs. PTX/KN93, ****p<0.0001, PTX vs. PTX/H89, ****p<0.0001, n = 5 biological replicates). Dashed line indicates the DMSO control. (D) Quantification of PP2A activity after 1 hr TTX treatment (Un, n = 5, TTX, n = 5; paired t-test: **p=0.0018). (E) Quantification of PP2A activity after 24 hr TTX treatment (Un, n = 7, TTX, n = 7; paired t-test: *p=0.0129). (F, G) Western blot analyses showing changes in S1615 phosphorylation after 1 hr (F) or 24 hr (G) TTX treatment, with inhibition of PP2A by okadaic acid (OKA, 50 nM) during the
    Drug H89 Tocris, supplied by Tocris, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/h89+tocris/H+89+dihydrochloride/10__7554_slash_elife__74277-253-196-198
    Average 95 stars, based on 1 article reviews
    drug h89 tocris - by Bioz Stars, 2026-11
    95/100 stars
    		  Buy from Supplier
    pka inhibitor h89 tocris 2910  (Tocris)
    90
    Tocris pka inhibitor h89 tocris 2910
    CRACE reduced lipogenesis and induced lipolysis in mature 3T3-L1 adipocytes by increasing cAMP level and <t>PKA</t> activation. a . mRNA expression analysis of lipogenesis related genes in CRACE treated and untreated mature adipocytes. b . mRNA expression analysis of major players of TAG lipolysis in CRACE treated and untreated mature adipocytes. In panel a and b mature adipocytes received CRACE (500 μg/mL equivalent) for 4 days. Bars represent mean ± SEM. n = 3. * p < 0.05 for untreated vs. CRACE treated. c . Treatment with CRACE (500 μg/mL equivalent) for 3 h increased lipolysis in mature 3T3-L1 adipocytes as measured by glycerol release. Isoproterenol (10 μM) was used as positive control. CRACE also increased lipolysis in cells where basal lipolysis was normalised with 100 nM adenosine (A) and 1 U/mL of adenosine deaminase (AD) treatment. Bars represent mean ± SEM. n = 3. * indicates p < 0.05 for untreated vs. different treatments and # indicates p < 0.05 for A + AD vs. A + AD + different treatments. d . CRACE increased PLN1 phosphorylation and decreased Akt phosphorylation (S473). Mature 3T3-L1 adipocytes were treated with CRACE (500 μg/mL equivalent) for 24 h followed by western blot analysis. Bars represent mean ± SEM, n = 3. * p < 0.05 for untreated vs. CRACE treated adipocytes. e . CRACE (500 μg/mL equivalent) increased intracellular cAMP level in mature 3T3-L1 adipocytes. 0.5 mM IBMX was added in all the cells for cAMP sustenance. Bars represent mean ± SEM, n = 3. * p < 0.05 for untreated vs. treated adipocytes. f . CRACE stimulated lipolysis by PKA activation in mature 3T3-L1 adipocytes. Glycerol release induced in mature adipocytes by CRACE (500 μg/mL equivalent) or isoproterenol in presence or absence of PKA inhibitor <t>H89</t> was measured. CRACE induced lipolysis was significantly reduced by H89. Bars represent mean ± SEM, n = 3. * p < 0.05 for ‘given treatments’ vs. ‘treatment + H89’ (i.e. Untreated vs H89; CRACE vs CRACE + H89; ISO + CRACE vs ISO + CRACE + H89). Unpaired t-test (for panel 4 a , 4 b , 4 d and 4 e ) and one-way ANOVA followed by Bonferroni post-test (for panel 4 c and 4 f ) was performed to evaluate the statistical significance
    Pka Inhibitor H89 Tocris 2910, supplied by Tocris, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/h89+tocris/h89+tocris++2910/pmc06883588-109-27-30
    Average 90 stars, based on 1 article reviews
    pka inhibitor h89 tocris 2910 - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    Figure 4. Increased PP2A activity maintains tetrodotoxin (TTX)-induced Shank3 hypophosphorylation. (A) Diagram showing the potential roles of kinases and phosphatases in regulating activity-dependent Shank3 phosphorylation. (B) Representative Western blot showing the impacts of inhibiting CAMKII (KN62, KN93) or PKA (H89) on Shank3 phosphorylation at baseline and upon TTX treatment. (C) Quantification of S1615 phosphorylation in (B) (two-way ANOVA with post-hoc Tukey’s test: DMSO vs. KN62, p>0.9999, DMSO vs. KN93, p=0.8148, DMSO vs. H89, p=0.9112, DMSO vs. picrotoxin (PTX), *p=0.0406, PTX vs. PTX/KN62, **p=0.0040, PTX vs. PTX/KN93, ****p<0.0001, PTX vs. PTX/H89, ****p<0.0001, n = 5 biological replicates). Dashed line indicates the DMSO control. (D) Quantification of PP2A activity after 1 hr TTX treatment (Un, n = 5, TTX, n = 5; paired t-test: **p=0.0018). (E) Quantification of PP2A activity after 24 hr TTX treatment (Un, n = 7, TTX, n = 7; paired t-test: *p=0.0129). (F, G) Western blot analyses showing changes in S1615 phosphorylation after 1 hr (F) or 24 hr (G) TTX treatment, with inhibition of PP2A by okadaic acid (OKA, 50 nM) during the

    Journal: eLife

    Article Title: A bidirectional switch in the Shank3 phosphorylation state biases synapses toward up- or downscaling

    doi: 10.7554/elife.74277

    Figure Lengend Snippet: Figure 4. Increased PP2A activity maintains tetrodotoxin (TTX)-induced Shank3 hypophosphorylation. (A) Diagram showing the potential roles of kinases and phosphatases in regulating activity-dependent Shank3 phosphorylation. (B) Representative Western blot showing the impacts of inhibiting CAMKII (KN62, KN93) or PKA (H89) on Shank3 phosphorylation at baseline and upon TTX treatment. (C) Quantification of S1615 phosphorylation in (B) (two-way ANOVA with post-hoc Tukey’s test: DMSO vs. KN62, p>0.9999, DMSO vs. KN93, p=0.8148, DMSO vs. H89, p=0.9112, DMSO vs. picrotoxin (PTX), *p=0.0406, PTX vs. PTX/KN62, **p=0.0040, PTX vs. PTX/KN93, ****p<0.0001, PTX vs. PTX/H89, ****p<0.0001, n = 5 biological replicates). Dashed line indicates the DMSO control. (D) Quantification of PP2A activity after 1 hr TTX treatment (Un, n = 5, TTX, n = 5; paired t-test: **p=0.0018). (E) Quantification of PP2A activity after 24 hr TTX treatment (Un, n = 7, TTX, n = 7; paired t-test: *p=0.0129). (F, G) Western blot analyses showing changes in S1615 phosphorylation after 1 hr (F) or 24 hr (G) TTX treatment, with inhibition of PP2A by okadaic acid (OKA, 50 nM) during the

    Article Snippet: DOI: https://doi.org/10.7554/eLife.74277 19 of 31 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Recombinant DNA reagent pAAV- CMV- PI- EGFP- WPRE- bGH Gift from James M. Wilson Addgene# 105530; RRID:Addgene_105530 Commercial assay or kit Lipofectamine 2000 Thermo Fisher Scientific Cat# 11668- 027 Commercial assay or kit Gibson Assembly Master Mix New England Biolabs Cat# E2611S Commercial assay or kit Lambda protein phosphatase New England Biolabs Cat# P0753S Commercial assay or kit BCA Protein Assay Kit Thermo Fisher Scientific Cat# 23227 Commercial assay or kit Protein- G Magnetic Beads Thermo Fisher Scientific Cat# 88847 Commercial assay or kit SimplyBlue SafeStain Thermo Fisher Scientific Cat# LC6060 Commercial assay or kit PP2A Immunoprecipitation Phosphatase Assay Kit Millipore Cat# 17- 313 Commercial assay or kit Ni- NTA Superflow Agarose Beads QIAGEN Cat# 30410 Chemical compound, drug Tetrodotoxin Tocris Cat# 1069 Chemical compound, drug Bicuculline methobromide Tocris Cat# 0109 Chemical compound, drug Picrotoxin Sigma- Aldrich Cat# P1675 Chemical compound, drug Okadaic acid Santa Cruz Cat# sc- 3513 Chemical compound, drug Tautomycetin Tocris Cat# 2305 Chemical compound, drug Fostriecin Tocris Cat# 1840 Chemical compound, drug KN62 Tocris Cat# 1277 Chemical compound, drug KN93 Tocris Cat# 1278 Chemical compound, drug H89 Tocris Cat# 2910 Chemical compound, drug Sequencing- grade trypsin Promega Cat# V5111 Chemical compound, drug Tandem Mass Tag (TMT) 10plex Thermo Fisher Scientific Cat# 90110 Software, algorithm Image Lab Software Bio- Rad RRID:SCR_014210 https://www.bio-rad.com/en-us/product/imagelab-software?ID=KRE6P5E8Z&source_wt= imagelabsoftware_surl Software, algorithm ZEN Black Zeiss RRID:SCR_018163 https://www.zeiss.com Software, algorithm Metamorph Molecular Devices RRID:SCR_002368 http://www.moleculardevices.com/Products/Software/ Meta-Imaging-Series/MetaMorph.html Software, algorithm Fiji Fiji RRID:SCR_002285 http://fiji.sc Software, algorithm GraphPad Prism GraphPad RRID:SCR_002798 http://www.graphpad.com/ Software, algorithm IGOR pro Wavemetrics RRID:SCR_000325 https://www.wavemetrics. com/products/igorpro/igorpro.htm Software, algorithm Spectrum mill v.7.00.208 Agilent Technologies Software, algorithm R v 4.0 The R Foundation RRID:SCR_001905 https://www.R-project.org/ Continued Continued on next page Wu, Tatavarty, Jean Beltran, et al. eLife 2022;11:e74277.

    Techniques: Activity Assay, Phospho-proteomics, Western Blot, Control, Inhibition

    CRACE reduced lipogenesis and induced lipolysis in mature 3T3-L1 adipocytes by increasing cAMP level and PKA activation. a . mRNA expression analysis of lipogenesis related genes in CRACE treated and untreated mature adipocytes. b . mRNA expression analysis of major players of TAG lipolysis in CRACE treated and untreated mature adipocytes. In panel a and b mature adipocytes received CRACE (500 μg/mL equivalent) for 4 days. Bars represent mean ± SEM. n = 3. * p < 0.05 for untreated vs. CRACE treated. c . Treatment with CRACE (500 μg/mL equivalent) for 3 h increased lipolysis in mature 3T3-L1 adipocytes as measured by glycerol release. Isoproterenol (10 μM) was used as positive control. CRACE also increased lipolysis in cells where basal lipolysis was normalised with 100 nM adenosine (A) and 1 U/mL of adenosine deaminase (AD) treatment. Bars represent mean ± SEM. n = 3. * indicates p < 0.05 for untreated vs. different treatments and # indicates p < 0.05 for A + AD vs. A + AD + different treatments. d . CRACE increased PLN1 phosphorylation and decreased Akt phosphorylation (S473). Mature 3T3-L1 adipocytes were treated with CRACE (500 μg/mL equivalent) for 24 h followed by western blot analysis. Bars represent mean ± SEM, n = 3. * p < 0.05 for untreated vs. CRACE treated adipocytes. e . CRACE (500 μg/mL equivalent) increased intracellular cAMP level in mature 3T3-L1 adipocytes. 0.5 mM IBMX was added in all the cells for cAMP sustenance. Bars represent mean ± SEM, n = 3. * p < 0.05 for untreated vs. treated adipocytes. f . CRACE stimulated lipolysis by PKA activation in mature 3T3-L1 adipocytes. Glycerol release induced in mature adipocytes by CRACE (500 μg/mL equivalent) or isoproterenol in presence or absence of PKA inhibitor H89 was measured. CRACE induced lipolysis was significantly reduced by H89. Bars represent mean ± SEM, n = 3. * p < 0.05 for ‘given treatments’ vs. ‘treatment + H89’ (i.e. Untreated vs H89; CRACE vs CRACE + H89; ISO + CRACE vs ISO + CRACE + H89). Unpaired t-test (for panel 4 a , 4 b , 4 d and 4 e ) and one-way ANOVA followed by Bonferroni post-test (for panel 4 c and 4 f ) was performed to evaluate the statistical significance

    Journal: BMC Complementary and Alternative Medicine

    Article Title: 1α, 25-dihydroxy Vitamin D3 containing fractions of Catharanthus roseus leaf aqueous extract inhibit preadipocyte differentiation and induce lipolysis in 3T3-L1 cells

    doi: 10.1186/s12906-019-2754-7

    Figure Lengend Snippet: CRACE reduced lipogenesis and induced lipolysis in mature 3T3-L1 adipocytes by increasing cAMP level and PKA activation. a . mRNA expression analysis of lipogenesis related genes in CRACE treated and untreated mature adipocytes. b . mRNA expression analysis of major players of TAG lipolysis in CRACE treated and untreated mature adipocytes. In panel a and b mature adipocytes received CRACE (500 μg/mL equivalent) for 4 days. Bars represent mean ± SEM. n = 3. * p < 0.05 for untreated vs. CRACE treated. c . Treatment with CRACE (500 μg/mL equivalent) for 3 h increased lipolysis in mature 3T3-L1 adipocytes as measured by glycerol release. Isoproterenol (10 μM) was used as positive control. CRACE also increased lipolysis in cells where basal lipolysis was normalised with 100 nM adenosine (A) and 1 U/mL of adenosine deaminase (AD) treatment. Bars represent mean ± SEM. n = 3. * indicates p < 0.05 for untreated vs. different treatments and # indicates p < 0.05 for A + AD vs. A + AD + different treatments. d . CRACE increased PLN1 phosphorylation and decreased Akt phosphorylation (S473). Mature 3T3-L1 adipocytes were treated with CRACE (500 μg/mL equivalent) for 24 h followed by western blot analysis. Bars represent mean ± SEM, n = 3. * p < 0.05 for untreated vs. CRACE treated adipocytes. e . CRACE (500 μg/mL equivalent) increased intracellular cAMP level in mature 3T3-L1 adipocytes. 0.5 mM IBMX was added in all the cells for cAMP sustenance. Bars represent mean ± SEM, n = 3. * p < 0.05 for untreated vs. treated adipocytes. f . CRACE stimulated lipolysis by PKA activation in mature 3T3-L1 adipocytes. Glycerol release induced in mature adipocytes by CRACE (500 μg/mL equivalent) or isoproterenol in presence or absence of PKA inhibitor H89 was measured. CRACE induced lipolysis was significantly reduced by H89. Bars represent mean ± SEM, n = 3. * p < 0.05 for ‘given treatments’ vs. ‘treatment + H89’ (i.e. Untreated vs H89; CRACE vs CRACE + H89; ISO + CRACE vs ISO + CRACE + H89). Unpaired t-test (for panel 4 a , 4 b , 4 d and 4 e ) and one-way ANOVA followed by Bonferroni post-test (for panel 4 c and 4 f ) was performed to evaluate the statistical significance

    Article Snippet: To test the effect of PKA inhibition on CRACE induced lipolysis, mature adipocytes were serum starved for 3 h. The cells were then pre-treated with 20 μM PKA inhibitor H89 (Tocris 2910) for 1 h in lipolysis buffer, followed by 3 h treatment with 500 μg/mL equivalent CRACE or 10 μM isoproterenol individually or together in presence of 20 μM H89.

    Techniques: Activation Assay, Expressing, Positive Control, Phospho-proteomics, Western Blot